Journal: Journal of Nanobiotechnology

Article Title: Chitosan Hydrogel as siRNA vector for prolonged gene silencing

doi: 10.1186/1477-3155-12-23

Figure Lengend Snippet: Prolonged gene silencing by siRNA/hydrogel complex. Cells were treated by hydrogel loaded with siR-RANK for 3, 6, and 9 days. Cells transfected via TransIT TKO/siR-RANK was included as positive control, and other controls included untransfected cells (UTR), empty hydrogel (Gel), or hydrogel formulated with siR-EGFP and TKO/siR-EGFP. The knockdown efficiency was evaluated by Real Time RT-PCR. RANK mRNA expression was normalized with β-actin and the relative RANK mRNA expression was calculated with UTR set to 1 and the data was presented as mean ± SD (n = 3). *p < 0.05 compared to untransfected cells.

Article Snippet: Three siRNA duplexes targeting RANK (siRNA1, siRNA2, and siRNA3) were ordered from GenePharma (Shanghai, China).

Techniques: Transfection, Positive Control, Knockdown, Quantitative RT-PCR, Expressing

Journal: Journal of Nanobiotechnology

Article Title: Chitosan Hydrogel as siRNA vector for prolonged gene silencing

doi: 10.1186/1477-3155-12-23

Figure Lengend Snippet: Viability for cells incubated with chitosan hydrogel alone or coupled with siRNA. Cell viability was assessed by MTT assay at 72 h post-transfection. The relative absorbance (at 570 nm) was measured and normalized to the level of non-treated control. Data was presented as mean ± SD (n = 3).

Article Snippet: Three siRNA duplexes targeting RANK (siRNA1, siRNA2, and siRNA3) were ordered from GenePharma (Shanghai, China).

Techniques: Incubation, MTT Assay, Transfection, Control

Journal: Journal of Nanobiotechnology

Article Title: Chitosan Hydrogel as siRNA vector for prolonged gene silencing

doi: 10.1186/1477-3155-12-23

Figure Lengend Snippet: Cumulative release profile of siRNA from chitosan hydrogel/siRNA. The formulated hydrogel was degraded either in PBS alone (marked as PBS) or PBS contained lysozyme (marked as LYS). Fluorescence intensity was measured for samples collected from various time points and background level from blank well was subtracted. The accumulative release profiles were calculated based on concentrations obtained. Data was presented as mean ± SD (n = 3).

Article Snippet: Three siRNA duplexes targeting RANK (siRNA1, siRNA2, and siRNA3) were ordered from GenePharma (Shanghai, China).

Techniques: Fluorescence

Journal: Journal of Nanobiotechnology

Article Title: Chitosan Hydrogel as siRNA vector for prolonged gene silencing

doi: 10.1186/1477-3155-12-23

Figure Lengend Snippet: Release profile of Cy5 labeled siRNA complexed within hydrogel in mice. Mice were injected s.c. with chitosan hydrogel/Cy5-siRNA, Cy5-siRNA alone and PBS buffer (n = 4). Fluorescent optical imaging was performed at the indicated time points after injection. (A) , Images from 2 mice 0, 1, 2, 4 and 7 days after injection with chitosan hydrogen/Cy5-siRNA and images from 2 mice 0 and 1 day after injection with Cy5-siRNA alone. Two mice injected with buffer (Two mice on the left in each panel) were included as control for both scanning. (B) , After quantifying the signal intensity of images, siRNA release was calculated as reduction of fluorescent signal: (RE (0 h) – RE (Designed Time Point)) /RE (0 h) * 100%. Average value from each time point (0, 1, 2 h, and 1, 2, 4, 7, 14 d) was presented (mean ± SD, n = 4).

Article Snippet: Three siRNA duplexes targeting RANK (siRNA1, siRNA2, and siRNA3) were ordered from GenePharma (Shanghai, China).

Techniques: Labeling, Injection, Optical Imaging, Control

Journal: Journal of Nanobiotechnology

Article Title: Chitosan Hydrogel as siRNA vector for prolonged gene silencing

doi: 10.1186/1477-3155-12-23

Figure Lengend Snippet: Relative position of chitosan/siRNA hydrogel in transwell during cell culture.

Article Snippet: Three siRNA duplexes targeting RANK (siRNA1, siRNA2, and siRNA3) were ordered from GenePharma (Shanghai, China).

Techniques: Cell Culture

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: Expression of XEDAR in different differentiation of GC tissues and adjacent normal tissues. Representative micrographs of (A) H&E staining and (B) immunohistochemistry (IHC) for expression of XEDAR in 30 gastritis tissues (Control), 38 moderately/high differentiated GC tissues and 31 low differentiated GC tissues. The images were at a magnification of ×100. (C) RT-qPCR analysis for and the expression of XEDAR mRNA in 30 gastritis tissues (Control), 38 moderately/high differentiated GC tissues and 31 low differentiated GC tissues. (D) Western blot was used to detect the relative expression level of XEDAR protein in Control, moderately/high differentiated GC tissues and low differentiated GC tissues. (E) Kaplan–Meier overall survival analyses were used to investigate the relationship between XEDAR expression and GC patient survival. (F and G) RT-qPCR and Western blot was respectively performed to determine the mRNA and protein expression of XEDAR in GC cell lines and normal gastric epithelial cell line. * P < 0.05 ( vs . Control), # P < 0.05 ( vs . Moderate/high differentiation).

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Expressing, Staining, Immunohistochemistry, Control, Quantitative RT-PCR, Western Blot

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: XEDAR Overexpression Inhibits Cell Proliferation and Migration in GC Cells. MKN45 cells (1.0 × 105/cm2) were transfected with control pcDNA3.1 (+) (vector) and different concentrations (0.1 µg/ml, 0.5 µg/ml, and 1 µg/ml) of pcDNA3.1 (+)-XEDAR (pcDNA-XEDAR) for 48 h. (A) RT-qPCR analysis for XEDAR mRNA expression in MKN45 cells. (B) Western blot analysis for XEDAR protein levels in MKN45 cells. (C) The proliferation of MKN45 cells was evaluated by EdU (5-ethynyl-2’-deoxyuridine) assay. (D) The migration of MKN45 cells was assessed by Transwell migration assay. (E) The colony formation of MKN45 cells was assessed by plate colony formation assay. * P < 0.05 ( vs . Vector). # P < 0.05 ( vs . 0.1 µg/ml of pcDNA-XEDAR).

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Over Expression, Migration, Transfection, Control, Plasmid Preparation, Quantitative RT-PCR, Expressing, Western Blot, Transwell Migration Assay, Colony Assay

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: XEDAR knockdown facilitates cell proliferation and migration in GC cells. MKN45 cells (1.0 × 105/cm2) were transfected with control siRNA (Scramble) and specific siRNAs against XEDAR (XEDAR siRNAs, 40 nM) for 48 h. (A) RT-qPCR analysis was used to confirm the interference efficiencies. Then, siRNA1 was used in the following experiments. (B) Western blot analysis was used to confirm interference efficiency of siRNA1. (C) The proliferation of MKN45 cells was evaluated by EdU assay. (D) The migration of MKN45 cells was assessed by Transwell migration assay. (E) The colony formation of MKN45 cells was assessed by plate colony formation assay. * P < 0.05 ( vs . Scramble).

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Knockdown, Migration, Transfection, Control, Quantitative RT-PCR, Western Blot, EdU Assay, Transwell Migration Assay, Colony Assay

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: Effects of XEDAR on Wnt/β-catenin signaling pathway in MKN45 cells. MKN45 cells (1.0 × 105/cm2) were transfected with control siRNA (Scramble, 40 nM), specific siRNA against XEDAR (XEDAR siRNA, 40 nM), control pcDNA3.1(+) (vector, 1 µg/ml) or pcDNA-XEDAR (XEDAR, 1 µg/ml) for 48 h. RT-qPCR (A) and Western blot (B) analysis determined the relative expression of CD44, Cyclin D1 and β-catenin proteins in “Vector”, “XEDAR”, “Scramble” and “siXEDAR” groups cells. (C) and (D) RT-qPCR analysis determined the relative expression of markers of gastric epithelial maturation differentiation (ATP4A, ATP4B, MIST1, Pepsinogen I, GAST, TFF1, and GKN1) and markers of gastric epithelial dedifferentiation (Villin 1 and SOX9) in MKN45 cells transfected with pcDNA-XEDAR or XEDAR siRNA, respectively. (E) Western blot analysis determined the relative expression of EMT-related proteins (E-cadherin, N-cadherin, and Snail) in transfected MKN45 cells. * P < 0.05.

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Transfection, Control, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Expressing

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: XEDAR promotes the migration and differentiation of GC cells through downregulating LXRα and activating the Wnt/β-catenin pathway. MKN45 cells (1.0 × 105/cm2) were incubated with 1 µg/ml pcDNA3.1 (+) empty vector (vector), 1 µg/ml pcDNA-XEDAR expression vector (XEDAR), 20 nM GSK2033, or 10 µM Wnt agonist 1, respectively for 48 h. (A) Western blot analysis for LXRα protein expression in MKN45 cells. (B) Relative expression of XEDAR, LXRα, CD44, Cyclin D1 and β-catenin proteins in “Vector”, “XEDAR”, “GSK2033” and “Wnt agonist 1” groups cells were assessed by Western blot analysis. (C) The proliferation of MKN45 cells was evaluated by EdU assay. (D) The migration of MKN45 cells was assessed by Transwell migration assay. * P < 0.05 ( vs . Vector). # P < 0.05 ( vs . 0.1 µg/ml of pcDNA-XEDAR). @ P < 0.05 ( vs . XEDAR)

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Migration, Incubation, Plasmid Preparation, Expressing, Western Blot, EdU Assay, Transwell Migration Assay

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: RELA transcriptionally regulates LXRα expression. (A) A diagrammatic sketch for LXRα gene structure and details of the RELA binding motif on LXRα gene promoter sequence. Gray areas represent the untranslated regions; Dark blue areas represent the translated (protein coding) regions; Blue lines represent the exons; Green arrows indicate the transcription direction. (B) The binding ability of RELA with LXRα promoter evaluated by ChIP-qPCR assay. Input: 30% of total cell lysates. *** P < 0.001. (C) The mRNA levels of RELA and LXRα in MKN45 cells transfected with vector, 0.5 µg/ml pcDNA-XEDAR and 1 µg/ml pcDNA-XEDAR. (D) The protein levels of RELA, LXRα, CyclinD1 and β-catenin in MKN45 cells transfected with vector, 0.5 µg/ml pcDNA-XEDAR and 1 µg/ml pcDNA-XEDAR. * P < 0.05 ( vs . Vector). # P < 0.05 ( vs . 0.5 µg/ml of pcDNA-XEDAR).

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Expressing, Binding Assay, Sequencing, ChIP-qPCR, Transfection, Plasmid Preparation

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: RELA mediates the regulation of XEDAR on LXRα and negatively regulates cell proliferation and migration in MKN45 cells. RT-qPCR (A) and Western blot (B) analysis confirmed the interference efficiencies of three different RELA siRNAs. About 50 nM RELA siRNA2, which was described as RELA siRNA, was used to incubate with the MKN45 cells alone or together with 1 µg/ml pcDNA-XEDAR. After incubation for 48 h, the cells were harvested and applied into analyses as follows: (C) The mRNA levels of XEDAR, RELA, LXRα, CD44, CyclinD1 and β-catenin were detected with qPCR. (D) The protein levels of XEDAR, RELA, LXRα, CD44, CyclinD1 and β-catenin were detected with Western blot. (E) Cell proliferation and (F) cell migration was respectively evaluated by EdU and Transwell migration. (G) Western blot analysis determined the relative expression of EGFR and FXOM1 protein in transfected MKN45 cells. * P < 0.05.

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Migration, Quantitative RT-PCR, Western Blot, Incubation, Expressing, Transfection

Journal: Cell Transplantation

Article Title: Tumor Suppressor Gene XEDAR Promotes Differentiation and Suppresses Proliferation and Migration of Gastric Cancer Cells Through Upregulating the RELA/LXRα Axis and Deactivating the Wnt/β-Catenin Pathway

doi: 10.1177/0963689721996346

Figure Lengend Snippet: Overexpression of XEDAR inhibited xenograft tumor growth in vivo . BALB/c nude mice were subcutaneously injected with 1×107 Vector or pcDNA XEDAR stably transfected MKN45 cells in the right side of the back to establish the subcutaneous xenograft tumor model. (A) Representative photographs of xenograft tumors in pcDNA XEDAR and Vector groups. (B) Growth curves of tumor growth in pcDNA XEDAR and Vector groups. (C) Tumor weight was assessed in each group. (D) Representative micrographs of H&E staining for tumor tissues. (F) Western blot analysis determined the relative expression of XEDAR, LXRα and β-catenin in the tumor tissues. * P < 0.05 (vs. Vector).

Article Snippet: Three XEDAR short interfering RNA (siRNA1, siRNA2, and siRNA3) and three RELA short interfering RNA (siRNA1, siRNA2, and siRNA3) molecules used in this study were designed and synthesized by MyBioSource (San Diego, CA, USA).

Techniques: Over Expression, In Vivo, Injection, Plasmid Preparation, Stable Transfection, Transfection, Staining, Western Blot, Expressing

Journal: European Journal of Histochemistry : EJH

Article Title: Dexmedetomidine attenuates neuroinflammation and microglia activation in LPS-stimulated BV2 microglia cells through targeting circ-Shank3/mir-140-3p/TLR4 axis

doi: 10.4081/ejh.2023.3766

Figure Lengend Snippet: Circ-Shank3 acts as the sponge of miR-140-3p. A ) RT-qPCR analysis of circ-Shank3 or miR-140-3p level in LPS-treated BV2 cells. B ) BV2 cells were treated with 20 μg/mL Dex, followed by treatment with 10 μg/mL LPS; RT-qPCR analysis of circ-Shank3 or miR- 140-3p level in BV2 cells. C ) Luciferase reporter assay showed the molecular combination of miR-140-3p with circ-Shank3 wild type. D ) The location of circ-Shank3 (green color) and miR-140-3p (red color) were detected by FISH analysis; DAPI, blue color. E ) RT-qPCR analysis of circ-Shank3 level in BV2 cells transfected with siRNA-ctrl, circ-Shank3 siRNA1, siRNA2 or siRNA3. F ) RT-qPCR analysis of miR-140-3p level in BV2 cells transfected with siRNA-ctrl or circ-Shank3 siRNA1. **p<0.01.

Article Snippet: MiR-140-3p mimics, miR-140-3p inhibitor, miRNA negative control (NC) and circ-Shank3 siRNA (circ-Shank3 siRNA1, circshank3 siRNA2 and circ-Shank3 siRNA3) and siRNA NC were purchased from Ribobio.

Techniques: Quantitative RT-PCR, Luciferase, Reporter Assay, Transfection

Journal: European Journal of Histochemistry : EJH

Article Title: Dexmedetomidine attenuates neuroinflammation and microglia activation in LPS-stimulated BV2 microglia cells through targeting circ-Shank3/mir-140-3p/TLR4 axis

doi: 10.4081/ejh.2023.3766

Figure Lengend Snippet: Circ-Shank3/miR-140-3p targets TLR4 in BV2 cells. A ) The potential binding site of miR-140-3p and TLR4. B ) Luciferase reporter assay showed the molecular combination of miR-140-3p with TLR4 mRNA wild type. C ) RT-qPCR analysis of miR-140-3p level in BV2 cells transfected with NC, miR-140-3p mimics or miR-140-3p inhibitor. D ) RT-qPCR analysis of TLR4 mRNA level in BV2 cells transfected with NC or miR-140-3p mimics. E ) BV2 cells were transfected with miR-140-3p mimics or circ-Shank3 siRNA1, followed by treatment with 10 μg/mL LPS. Western blot analysis of TLR4, p-p65 and p65 protein expressions in BV2 cells. **p<0.01.

Article Snippet: MiR-140-3p mimics, miR-140-3p inhibitor, miRNA negative control (NC) and circ-Shank3 siRNA (circ-Shank3 siRNA1, circshank3 siRNA2 and circ-Shank3 siRNA3) and siRNA NC were purchased from Ribobio.

Techniques: Binding Assay, Luciferase, Reporter Assay, Quantitative RT-PCR, Transfection, Western Blot

Journal: European Journal of Histochemistry : EJH

Article Title: Dexmedetomidine attenuates neuroinflammation and microglia activation in LPS-stimulated BV2 microglia cells through targeting circ-Shank3/mir-140-3p/TLR4 axis

doi: 10.4081/ejh.2023.3766

Figure Lengend Snippet: Dex attenuates neuroinflammation in BV2 cells exposed to LPS through modulating circ-Shank3/miR-140-3p/TLR4/NF-κB axis. BV2 cells were treated with 20 μg/mL Dex plus miR-140-3p mimics, circ-Shank3 siRNA1 or circ-Shank3 siRNA1 + miR-140-3p inhibitor, followed by treatment with 10 μg/mL LPS. A,B ) Immunofluorescence assay was used to estimate the expression of TLR4 and p65 in BV2 cells, based on the fluorescence intensity; TLR4 or p65, red color; DAPI, blue color. C ) Western blot analysis of TLR4, p-p65 and p65 protein expressions in BV2 cells. **p<0.01.

Article Snippet: MiR-140-3p mimics, miR-140-3p inhibitor, miRNA negative control (NC) and circ-Shank3 siRNA (circ-Shank3 siRNA1, circshank3 siRNA2 and circ-Shank3 siRNA3) and siRNA NC were purchased from Ribobio.

Techniques: Immunofluorescence, Expressing, Fluorescence, Western Blot

Journal: European Journal of Histochemistry : EJH

Article Title: Dexmedetomidine attenuates neuroinflammation and microglia activation in LPS-stimulated BV2 microglia cells through targeting circ-Shank3/mir-140-3p/TLR4 axis

doi: 10.4081/ejh.2023.3766

Figure Lengend Snippet: Dex reduces pro-inflammatory cytokines in BV2 cells exposed to LPS through modulating circ-Shank3/miR-140-3p axis. BV2 cells were treated with 20 μg/mL Dex plus miR-140-3p mimics, circ-Shank3 siRNA1 or circ-Shank3 siRNA1 + miR-140-3p inhibitor, followed by treatment with 10 μg/mL LPS. A-D ) ELISA analysis of TNF-α, IL-1β, IL-6 and MDA levels in the culture supernatant of BV2 cells. *p<0.05, **p<0.01.

Article Snippet: MiR-140-3p mimics, miR-140-3p inhibitor, miRNA negative control (NC) and circ-Shank3 siRNA (circ-Shank3 siRNA1, circshank3 siRNA2 and circ-Shank3 siRNA3) and siRNA NC were purchased from Ribobio.

Techniques: Enzyme-linked Immunosorbent Assay

Journal: European Journal of Histochemistry : EJH

Article Title: Dexmedetomidine attenuates neuroinflammation and microglia activation in LPS-stimulated BV2 microglia cells through targeting circ-Shank3/mir-140-3p/TLR4 axis

doi: 10.4081/ejh.2023.3766

Figure Lengend Snippet: Dex attenuates LPS-induced microglia activation by modulating circ-Shank3/miR-140-3p axis. BV2 cells were treated with 20 μg/mL Dex plus miR-140-3p mimics, circ-Shank3 siRNA1 or circ-Shank3 siRNA1 + miR-140-3p inhibitor, followed by treatment with 10 μg/mL LPS. A-C ) Immunofluorescence assay was used to estimate the expression of Iba-1, CD11b and BDNF in BV2 cells, based on the fluorescence intensity; Iba-1, CD11b or BDNF, red color; DAPI, blue color. *p<0.05, **p<0.01.

Article Snippet: MiR-140-3p mimics, miR-140-3p inhibitor, miRNA negative control (NC) and circ-Shank3 siRNA (circ-Shank3 siRNA1, circshank3 siRNA2 and circ-Shank3 siRNA3) and siRNA NC were purchased from Ribobio.

Techniques: Activation Assay, Immunofluorescence, Expressing, Fluorescence

Journal: European Journal of Histochemistry : EJH

Article Title: Dexmedetomidine attenuates neuroinflammation and microglia activation in LPS-stimulated BV2 microglia cells through targeting circ-Shank3/mir-140-3p/TLR4 axis

doi: 10.4081/ejh.2023.3766

Figure Lengend Snippet: A schematic model of Dex functions in POCD. Dex could attenuate neuroinflammation and microglia activation in LPS-treated BV2 cells by modulating circ-Shank3/miR-140-3p/TLR4/NF-κB axis.

Article Snippet: MiR-140-3p mimics, miR-140-3p inhibitor, miRNA negative control (NC) and circ-Shank3 siRNA (circ-Shank3 siRNA1, circshank3 siRNA2 and circ-Shank3 siRNA3) and siRNA NC were purchased from Ribobio.

Techniques: Activation Assay

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: Targeted overexpression of FHL3 in skeletal muscles by random integration significantly increases muscle growth and the proportion of fast-twitch muscle fibers. A Representative photographs of 2-month-old mice showing that FHL3 transgenic mice (TG) have a larger body and whiter meat color than wild-type (WT) mice. B The growth curve of male WT and TG mice showed that the body weight of male TG mice was significantly higher than that of male WT mice at the same week of age (n = 10 for each group). C, D Representative photographs of whole hind limb, quadricep (Qu), gastrocnemius (Gas), and tibialis anterior (TA) muscles of 2-month-old male WT and TG male mice (C). Quantification analysis showed that the weights of Qu, Gas, and TA muscles of male FHL3 TG mice were significantly higher than those of WT mice (n = 10 for each group) (D). Data were normalized to the body weight (BW) (mg/g). E Representative images of dystrophin immunohistochemistry staining for Qu, Gas, and TA muscles from 2-month-old FHL3 TG and WT mice. Quantification in ten independent experiments indicated that FHL3 mice had higher mean cross-sectional areas of individual myofibers than WT mice. At least 150 myofibers were analyzed in an independent experiment. Scale bars, 50 μm. F The exhaustive swimming time of 2-month-old mice showed that the swimming time of TG mice was shorter than that of WT mice (n = 10 for each group). G Grip strength of 2-month-old mice showed that the muscle grip strength of TG mice was stronger than that of WT mice (n = 10 for each group). The strength test was performed using a grip strength meter (BIO-GS3; Bioseb, France). H Representative immunohistology images of fast-twitch and slow-twitch muscle fiber types for Gas muscles from 2-month-old FHL3 TG and WT mice. Quantification in five independent experiments indicated that FHL3 TG mice had a higher proportion of fast-twitch muscle fibers and a lower proportion of slow-twitch muscle fibers than WT mice. Fast-twitch muscle fibers were indicated by red, slow-twitch muscle fibers were indicated by green, and DAPI was indicated by blue, respectively. At least 150 myofibers were analyzed in an independent experiment. Scale bars, 50 μm. I Representative immunohistology images of MyHC2b (type IIb) muscle fiber types for Gas muscles from 2-month-old FHL3 TG and WT mice. Quantification in five independent experiments indicated that FHL3 TG mice had a higher percentage of MyHC2b muscle fibers than WT mice. MyHC2b muscle fibers were indicated by red, myosin muscle fibers were indicated by green, and DAPI was indicated by blue, respectively. At least 150 myofibers were analyzed in an independent experiment. Scale bars, 50 μm. J Western blotting results showed that the expression levels of FHL3, MyHC2a, and MyHC2b in Gas muscles of TG mice were significantly increased, while the expression level of MyHC1/ slow was significantly decreased compared with WT mice (n = 6 mice for each group). The relative protein levels were normalized to β-actin. K, L Muscle enzyme activity of Gas muscles from 2-month-old mice showed that the LDH enzyme activity (K) of TG mice was significantly higher than that of WT mice, but the SDH enzyme activity (L) of TG mice was significantly lower than that of WT mice (n = 9). M The O2 consumption (VO2) and quantification results showed the TG mice had lower oxygen consumption than WT mice during the dark cycle (n = 5 for each group). Mice were put individually into a metabolic cage. The VO2 was measured by built-in detector. Dot plot reflected the data from independent experiment. The data were presented as mean ± SD of independent experiments; *P < 0.05, **P < 0.01, ***P < 0.001

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Over Expression, Muscles, Transgenic Assay, Immunohistochemistry, Staining, Western Blot, Expressing, Activity Assay

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: FHL3 directly interacts with ZN2 domain of YY1 and decreases its binding capacities to MyHC2b gene regulatory region. A C2C12 myoblasts were co-transfected with pcDNA3.1-FHL3 and YY1 siRNA (indicated at the bottom) and differentiated for 4 days. The cell lysates were subject to western blotting with anti-FHL3, anti-YY1 and anti-MyHC2b (indicated at the left). Western blotting results showed that knockdown of YY1 could reduce the promotion effect of FHL3 overexpression on MyHC2b expression. The relative protein levels were normalized to β-actin. The data were presented as mean ± SD of three independent experiments; *P < 0.05, **P < 0.01. B C2C12 myoblasts were co-transfected with FHL3 siRNA and pcDNA3.1-YY1, and then differentiated for 4 days. The cell lysates were subject to western blotting with anti-FHL3, anti-YY1, and anti-MyHC2b. Western blotting results showed that FHL3 knockdown could increase the inhibitory effects of YY1 overexpression on MyHC2b expression. The relative protein levels were normalized to β-actin. The data were presented as mean ± SD of three independent experiments; *P < 0.05, ***P < 0.001. C Immunofluorescence staining showed that FHL3 protein co-located with YY1 in cell nucleus of C2C12 myoblasts differentiated for 2 days. C2C12 myoblasts were stained with anti-FHL3 (red), anti-YY1 (green), and DAPI (blue), and were imaged by confocal laser scanning microscopy. Scale bars, 5 μm. D, E The co-immunoprecipitation (Co-IP) results showing the interaction of FHL3 and YY1 in vivo. C2C12 myoblasts were differentiated for 2 days, harvested and co-immunoprecipitated with anti-FHL3 or anti-IgG (D) and with anti-IgG or anti-YY1 (E). IgG was used as a negative control. The total cell lysates before immunoprecipitation were used as input to verify expression of FHL3 and YY1. F Schematic diagram of different truncated fragments of FHL3 (up) and GST pulldown assays. In vitro translated proteins of GST, GST-FHL3-LIM1/2 (1–39), GST-FHL3-LIM1 (40–98), GST-FHL3-LIM2 (99–159), GST-FHL3-LIM3 (160–218), GST-FHL3-LIM4 (219–289) with His-YY1 were used for GST pulldown assays. The GST pulldown results showed GST-FHL3 and each LIM domain of FHL3 could directly interact with His-YY1 in vitro (up), GST-tagged proteins were detected by western blotting with anti-GST (down). G Schematic diagram of different truncated fragments of YY1. YY1 functional domains include transactivation domain (YY1-TD; 1–99), repression domain (YY1-RD; 170–225), and DNA-binding domain (YY1-DD; 294–414). YY1-RD domain includes HAT-HDAC interaction domain (YY1-RD1; 170–200) and REPO domain (YY1-RD2; 200–225); YY1-DD domain includes four zinc finger domains (ZN): ZN1 (294–322), ZN2 (323–350), ZN3 (351–380) and ZN4 (381–414), respectively. H GST pulldown results indicated that GST-YY1-RD and GST-YY1-DD could interact with His-FHL3. In vitro translated proteins of GST, GST-YY1-TD, GST-YY1-RD, GST-YY1-DD, GSY-YY1, and His-FHL3 were used for GST pulldown assays. The interaction of GST-YY1 truncated proteins with His-FHL3 was detected by western blotting with anti-His (up). GST-tagged proteins were detected by western blotting with anti-GST (down). I GST pulldown indicated that GST-YY1-ZN2 could interact with His-FHL3. In vitro translated proteins of GST, GST-YY1-ZN1, GST-YY1-ZN2, GST-YY1-ZN3, GST-YY1-ZN4, GST-YY1-DD, and His-FHL3 were used for GST pulldown analysis. The interaction of GST-YY-DD truncated proteins with His-FHL3 was detected by western blotting with anti-His (up). GST-tagged proteins were detected by western blotting with anti-GST (down). J EMSA experiments were used to analyze the binding of GST, GST-YY1-ZN1, GST-YY1-ZN2, GST-YY1-ZN3, GST-YY1-ZN4, and GST-YY1-DD fusion proteins to MyHC2b regulatory regions in vitro. GST, and free H2O were used for negative control and blank control, respectively. The specific DNA–protein complex band was observed in the wild-type probes incubated with GST-YY1-ZN1, GST-YY1-ZN2, GST-YY1-ZN3, and GST-YY1-DD. K ChIP-qPCR results showed the YY1 enrichments at the MyHC2b regulatory regions were significantly decreased after FHL3 overexpression in C2C12 myoblasts differentiated for 2 days. IgG was performed as controls, and the precipitated DNA was amplified by PCR with primers for the MyHC2b gene regulatory region. *P < 0.05. L EMSA results showing the effect of the FHL3 on the binding capacity of YY1-DD to the MyHC 2b gene regulatory region in vitro. GST, and free H2O were used as negative and blank control, respectively. A specific DNA–protein complex band was observed in the wild-type probes incubated with GST-YY1-DD, while the DNA–protein complex band became weaker and a super band formed when His-FHL3 was added

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Binding Assay, Transfection, Western Blot, Knockdown, Over Expression, Expressing, Immunofluorescence, Staining, Confocal Laser Scanning Microscopy, Immunoprecipitation, Co-Immunoprecipitation Assay, In Vivo, Negative Control, In Vitro, Functional Assay, Control, Incubation, ChIP-qPCR, Amplification

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: Bioinformatics analysis of differentially expressed genes between WT and FHL3 knockout C2C12 cells revealed that YY1 may participate in the regulation of the formation of fast glycolytic muscle fibers by FHL3. A Western blotting results showed that FHL3 knockout significantly decreased the expression levels of MyHC2a and MyHC2b, but significantly increased the expression levels of MyHC1/slow in C2C12 cells differentiated for 4 days. B Volcano plot of differentially expressed genes (DEGs) between WT and FHL3 KO C2C12 cells. Blue: downregulated DEGs, red: upregulated DEGs. C GO enrichment dot plot of the differentially upregulated genes after FHL3 knockout. D Gene set enrichment analysis (GSEA) of DEGs related to ‘transition between fast and slow fiber.’ E Heatmap of differentially expressed fast-twitch and slow-twitch related genes. F qRT-PCR results showed that the expression levels of fast-switch related genes were significantly decreased, and the expression levels of slow-switch genes were significantly increased in FHL3 knockout cells compared with WT cells. G Veen diagram showing that YY1 was the common gene between 12 potential transcription factors that specifically bind to MyHC2b regulatory region by PROMO analysis and 87 regulatory factors predicted by RNA-seq DEGs BART analysis. The relative protein and mRNA levels were normalized to β-actin. The data were presented as mean ± SD of three independent experiments; P values were determined by paired t test. *P < 0.05, **P < 0.01, ***P < 0.001

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Knock-Out, Western Blot, Expressing, Quantitative RT-PCR, RNA Sequencing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: Lentivirus-mediated FHL3 knockdown in muscles significantly decreased muscle mass and the proportion of fast-twitch muscle fibers. A Injection diagram of the LV-shFHL3 and LV-shNC intramuscularly into the right and left legs of 1-month-old WT mice and representative photographs of hind limb, Qu, TA, and Gas muscles of 1-month-old mice showing the mice injected with LV-shFHL3 vector had redder meat color than mice injected with LV-shNC vector. The dose of lentivirus injection is shown in the schematic diagram. B Quantification of five independent experiments showed that lentivirus-mediated FHL3 knockdown significantly decreased the weights of hind limb, Qu, TA, and Gas muscles. P values are determined by paired t test. Data are normalized to the body weight (BW) (mg/g). C, D Representative images of dystrophin immunofluorescence (C) and H&E (D) staining for the Qua, TA, and Gas muscles of mice. Quantification in five independent experiments indicated that lentivirus-mediated FHL3 knockdown in muscles of mice significantly decreases the mean cross-sectional areas of individual myofibers. At least 150 myofibers were analyzed in an independent experiment. Scale bar, 50 μm. E Representative immunohistology images of fast-twitch and slow-twitch muscle fiber types for Gas muscles from 2-month-old mice injected with LV-shNC and LV-shFHL3 vectors. Quantification in five independent experiments indicated that lentivirus-mediated FHL3 knockdown in Gas muscles of mice significantly decreased the proportion of fast-twitch muscle fibers and increases the proportion of slow-twitch muscle fibers. Fast-twitch muscle fibers were indicated by red, slow-twitch muscle fibers were indicated by green, and DAPI was indicated by blue, respectively. At least 150 myofibers were analyzed in an independent experiment. Scale bars, 50 μm. F Representative immunohistology images of MyHC2b (type IIb) muscle fiber types for Gas muscles from 2-month-old mice injected with LV-shNC and LV-shFHL3 vectors. Quantification in five independent experiments indicated that lentivirus-mediated FHL3 knockdown in Gas muscles of mice significantly decreased the proportion of MyHC2b (type IIb) muscle fibers. MyHC2b muscle fibers were indicated by red, myosin muscle fibers were indicated by green, and DAPI was indicated by blue, respectively. At least 150 myofibers were analyzed in an independent experiment. Scale bars, 50 μm. G, H Western blotting (G) and qRT-PCR (H) results showed that lentivirus-mediated FHL3 knockdown in 2-month-old mice significantly decreased the expression levels of MyHC2a and MyHC2b, but significantly increased the expression level of MyHC1/slow. The relative protein and mRNA levels were normalized to β-actin. The data were presented as mean ± SD of independent experiments; P values were determined by paired t test. *P < 0.05, **P < 0.01, ***P < 0.001

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Knockdown, Muscles, Injection, Plasmid Preparation, Immunofluorescence, Staining, Western Blot, Quantitative RT-PCR, Expressing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: Pig FHL3 has the conserved function of promoting formation of fast-twitch muscle fibers. A Representative images of MyHC2a, MyHC2b, and MyHC1/slow immunofluorescence staining in pig skeletal muscle satellite cells (pSMSC) differentiated for 2 days. Quantification in three independent experiments indicated that lentivirus-mediated pig FHL3 overexpression (LV-pFHL3) significantly increased the proportion of MyHC2a- and MyHC2b-positive myotubes, and reduced the proportion of MyHC1/slow- positive myotubes compared with lentivirus-mediated pig empty vector (LV-Control). Nuclei were stained with DAPI. Scale bars, 50 μm. B Western blotting results in pSMSC differentiated for 2 days showed that lentivirus-mediated pFHL3 overexpression significantly increased the expression levels of MyHC2a and MyHC2b, but significantly decreased the expression levels of MyHC1/slow. The relative protein levels were normalized to β-actin. The data were presented as mean ± SD of three independent experiments. C Injection diagram of the lentivirus-mediated pFHL3 overexpression (LV-pFHL3) vector and empty control (LV-Control) vector intramuscularly into the right and left legs of 1-week-old pigs and representative images of dystrophin immunofluorescence staining for the Gas muscles of pigs. Quantification in three independent experiments indicated that lentivirus-mediated pFHL3 overexpression in Gas muscles significantly increased the mean cross-sectional areas of individual myofibers. At least 150 myofibers are analyzed in an independent experiment. P values were determined by paired t test. Scale bar, 50 μm. D Representative immunohistology images of fast-twitch and slow-twitch muscle fiber types for Gas muscles from 5-week-old pigs injected with LV-Control and LV-pFHL3 vectors. Quantification in three independent experiments indicated that lentivirus-mediated FHL3 overexpression in Gas muscles of pigs significantly increased the proportion of fast-twitch muscle fibers and decreased the proportion of slow-twitch muscle fibers. Fast-twitch muscle fibers were indicated by red, slow-twitch muscle fibers were indicated by green, and DAPI was indicated by blue, respectively. At least 150 myofibers were analyzed in an independent experiment. P values were determined by paired t test. Scale bars, 50 μm. E Representative immunohistology images of MyHC2b (type IIb) muscle fiber types for Gas muscles from 5-week-old pigs injected with LV-Control and LV-pFHL3 vectors. Quantification in three independent experiments indicated that lentivirus-mediated FHL3 overexpression in Gas muscles of pigs significantly increased the proportion of MyHC2b muscle fibers. MyHC2b muscle fibers were indicated by red, myosin muscle fibers were indicated by green, and DAPI was indicated by blue, respectively. At least 150 myofibers were analyzed in an independent experiment. P values were determined by paired t test. Scale bars, 50 μm. F Western blotting results show that lentivirus-mediated pFHL3 overexpression (LV-pFHL3) in pig muscles significantly increased the expression levels of MyHC2a and MyHC2b, but significantly decreased the expression level of MyHC1/slow. The data were presented as mean ± SD of three independent experiments; P values were determined by paired t test. The relative protein levels were normalized to β-actin. *P < 0.05, **P < 0.01

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Immunofluorescence, Staining, Over Expression, Plasmid Preparation, Control, Western Blot, Expressing, Injection, Muscles

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: YY1 directly binds to MyHC2b gene regulatory region and specifically represses its gene expression. A Luciferase reporter assay in C2C12 cells differentiated for 2 days indicated that the FHL3 overexpression significantly increased the transcription activities of the D5, D6, and D7 truncated fragments containing two putative YY1 binding motifs. Left panel, schematic diagram of eight truncated fragments of MyHC2b gene regulatory region linked to luciferase gene in pGL3 vector. The nucleotides were numbered relative to the translation start site that was assigned as + 1. Schematic diagram of two potential YY1 binding motifs (A, B) in truncated fragments of MyHC2b gene regulatory region were displayed. Right panel, the relative activities of a series of truncated fragments of the pGL3-MyHC2b construct determined by luciferase assay after transfection of FHL3 overexpression vector (pcDNA3.1-FHL3). B Schematic diagram of two YY1 binding sites (A, B) in MyHC2b gene regulatory region between nucleotides − 1100 bp and − 910 bp which were predicted by PROMO and mutated motifs. The dual luciferase assays showed that overexpression of FHL3 did not significantly enhance the fluorescence activity of MyHC2b D5 truncated fragment only when motif A was mutated. C ChIP-qPCR results showed that YY1 could bind to MyHC2b gene regulatory region in C2C12 cells differentiated for 2 days. IgG was performed as controls and precipitated DNA was amplified by PCR with primers for the MyHC2b gene regulatory region. D EMSA assays were used to analyze the binding of GST, free H2O, and GST-YY1 fusion protein to MyHC2b regulatory regions in vitro. GST, and free H2O were used for negative control and blank control, respectively. The specific DNA–protein complex band was observed in the WT probes incubated with GST-YY1. E Representative images of MyHC1/slow, MyHC2a, and MyHC2b immunofluorescence staining and quantification in three independent experiments indicated that YY1 overexpression (pcDNA3.1-YY1) significantly decreased the proportion of MyHC2b-positive myotubes, and did not significantly affect the proportion of MyHC1/slow- and MyHC2a-positive myotubes in C2C12 cells differentiated for 4 days. The myotubes were stained with anti-MyHC1/slow antibodies (red), anti-MyHC2a antibodies (red), anti-MyHC2b antibodies (red), and DAPI (blue). Scale bars, 50 μm. F Western blotting results showed that YY1 overexpression significantly decreased the expression levels of MyHC2b, and had no significant effects on the expression levels of MyHC1/slow and MyHC2a in C2C12 cells differentiated for 4 days. The relative protein levels were normalized to β-actin. The data were presented as mean ± SD of three independent experiments; *P < 0.05, **P < 0.01, N.S. indicates statistical non-significance

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Gene Expression, Luciferase, Reporter Assay, Over Expression, Binding Assay, Plasmid Preparation, Construct, Transfection, Fluorescence, Activity Assay, ChIP-qPCR, Amplification, In Vitro, Negative Control, Control, Incubation, Immunofluorescence, Staining, Western Blot, Expressing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: FHL3 reduces EZH2 recruitment to regulatory regions of MyHC2b by competitively interacting with YY1-RD2 domain. A GST pulldown results indicated that GST-YY1-RD1 and GST-YY1-RD2 could interact with His-FHL3 in vitro. In vitro translated proteins of GST, GST-YY1-RD1, GST-YY1-RD2, GST-YY1-RD, and His-FHL3 were used for GST pulldown assays. The interaction of GST-YY1 truncated proteins with His-FHL3 was detected by western blotting with anti-His (up). The GST-tagged proteins were detected by western blotting with anti-GST (down). B, C The Co-IP results showed that FHL3 overexpression (B) and knockdown (C) significantly decreased and increased the interaction of EZH2 with YY1 in vivo, respectively. C2C12 myoblasts differentiated for 2 days were co-immunoprecipitated with anti-YY1 or anti-IgG. The immunoprecipitated proteins were subject to western blotting with anti-FHL3, anti-YY1, and anti-EZH2 (indicated at the left). IgG was used as a negative control. The total cell lysates before immunoprecipitation were used as input to verify expression of FHL3, EZH2, and YY1. D The GST pulldown results indicated that addition of FHL3 fusion protein reduced the interaction His-EZH2 (465–519) with YY1 in vitro. In vitro translated proteins of GST, GST-YY1, His-EZH2 (465–519), and FHL3 were used for GST pulldown assays. The FHL3 fusion protein, GST, GST-YY1, and His-EZH2 (465–519) were detected by western blotting with anti-FHL3, anti-GST, and anti-His, respectively. E, F ChIP-qPCR results showed the EZH2 (E) and H3K27me3 (F) enrichments at the MyHC2b regulatory regions were significantly decreased after FHL3 overexpression in C2C12 myoblasts differentiated for 2 days. IgG was used as negative control, and the precipitated DNA was amplified by PCR with primers for the MyHC2b regulatory regions. G, H ChIP-qPCR results showed the EZH2 (G) and H3K27me3 (H) enrichments at the MyHC2b regulatory regions were significantly increased after FHL3 knockdown in C2C12 myoblasts differentiated for 2 days. IgG was used as negative control, and the precipitated DNA was amplified by PCR with primers for the MyHC2b regulatory regions. The data were presented as mean ± SD of three independent experiments; **P < 0.01, ***P < 0.001

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: In Vitro, Western Blot, Co-Immunoprecipitation Assay, Over Expression, Knockdown, In Vivo, Immunoprecipitation, Negative Control, Expressing, ChIP-qPCR, Amplification

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism

doi: 10.1007/s00018-022-04680-w

Figure Lengend Snippet: FHL3 reduces glucose tolerance and its expression is positively correlated with blood glucose values in patients with type 2 diabetes. A Heatmap of DEGs associated with glycolysis, TCA cycle, and OXPHOS. B qRT-PCR results showed that the expression levels of glycolysis-related genes were significantly decreased, and the expression levels of TCA cycle and OXPHOS-related genes were significantly increased in FHL3 knockout cells. C KEGG pathway of DEGs between WT and FHL3 KO C2C12 cells. D GTT results of WT and TG male mice showed the clearance of glucose from the circulation during GTT was significantly lower in TG mice compared with WT mice (n = 8 for each group). E ITT results of WT and TG male mice showed the clearance of glucose from the circulation during ITT was significantly lower in TG mice compared with WT mice (n = 8 for each group). F Volcano map of DEGs between normal people and diabetic patients (GSE: 29221) showed that the mRNA expression of FHL3 in muscle was significantly upregulated in diabetic patients. Blue: downregulated DEGs, red: upregulated DEGs. G Correlation analysis of gene expression data in diabetic patients (GSE: 202295) showed that the mRNA expression of FHL3 in muscle was positively correlated with HbA1c. H Schematic diagram depicting the molecular mechanism of fast glycolytic MyHC2b gene expression regulated by the interaction of FHL3 and YY1. YY1 functional domains contain transactivation domain (YY1-TD; 1–99), repression domain (YY1-RD; 170–225) and DNA-binding domain (YY1-DD; 294–414). YY1-RD domain includes HAT-HDAC interaction domain (YY1-RD1;170–200) and REPO domain (YY1-RD2; 200–225); YY1-DD domain includes four zinc finger domains (ZN): ZN1 (294–322), ZN2 (323–350), ZN3 (351–380) and ZN4 (381–414). FHL3 directly interacts with YY1-ZN2, weakening their binding to the MyHC2b regulatory region and thus upregulating MyHC2b gene expression. Moreover, FHL3 competes with EZH2 to bind YY1-RD2, and decreases H3K27me3 enrichment at the MyHC2b regulatory region, thereby increasing target gene expression. The relative mRNA levels were normalized to β-actin. The data were presented as mean ± SD of three independent experiments; *P < 0.05, **P < 0.01

Article Snippet: Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY1 siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense:GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).

Techniques: Expressing, Quantitative RT-PCR, Knock-Out, Gene Expression, Functional Assay, Binding Assay, Targeted Gene Expression

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: TREM2 is upregulated in OGDR and MCAO ischemic models. TREM2 levels in primary mouse microglia 0, 3, 6, 12, 24, 48, and 72h after OGDR as determined by quantitative real-time PCR ( a ) and western blotting ( b ). c Densitometric analysis of TREM2 (relative to GAPDH) from western blotting data in ( b ) presented as mean ± SEM; n = 6; * P < 0.05 compared with control. TREM2 levels in mice 6h, 1d, 3d, 7d, 14d, 21d and 28d after MCAO were detected by quantitative real-time PCR ( d ) and western blotting ( e ). f Densitometric analysis of TREM2 relative to GAPDH from data in ( e ) presented as mean ± SEM; n = 6; # P < 0.05 compared with sham

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques: Real-time Polymerase Chain Reaction, Western Blot, Control

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: TREM2 colocalizes with Iba1 + microglia, but not with NeuN + neurons, MBP + myelin, or GFAP + astrocytes in mice subjected to MCAO. Scale bar, 50 μm

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques:

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: TREM2 silencing exacerbates stroke outcomes. Tissue homogenates from the ischemic cerebral hemisphere (ischemic core and penumbra) of mice that underwent MCAO and 7 days of the indicated treatment were subjected to quantitative real-time PCR ( a ) and western blotting ( b ) and densitometric analysis ( c ) of TREM2 relative to GAPDH proteins. d Immunofluorescence labeling with NeuN ( red ) and TUNEL ( green ) of the indicated groups in vivo. e The percentage of apoptotic neurons was calculated using image analysis software. Quantified data are shown as mean ± SEM; n = 6. Scale bar, 50 μm. f Representative samples of TTC-stained brain sections showing the infarcted areas in white. g The infarct volume was determined using image analysis and expressed as a percentage of the whole cerebral tissue. Data are presented as mean ± SEM; n = 5. h Neurological function assessed by the Modified Garcia Score. Data are presented as mean ± SEM; n = 16; * P < 0.05 compared with sham; # P < 0.05 compared with the siRNA control. MCAO 7d, 7 days after mice were subjected to MCAO only; Con siRNA, mice subjected to MCAO followed by injections of scrambled siRNA for 7 days; TREM2 siRNA, mice subjected to MCAO followed by TREM2 siRNA injections for 7 days

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques: Real-time Polymerase Chain Reaction, Western Blot, Immunofluorescence, Labeling, TUNEL Assay, In Vivo, Software, Staining, Modification, Control

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: TREM2 is critical for the inflammatory response following OGDR. a OGDR was induced in cells, and the cells were transfected 6h and 12h later with TREM2 siRNA. TREM2 and GAPDH protein levels were measured by western blotting. Densitometric analysis of TREM2 relative to GAPDH is shown as mean ± SEM; n = 5; * P < 0.05 compared with control group; # P < 0.05 compared with siRNA control in cells transfected 6h after OGDR (OGDR6h + Con siRNA); Δ P < 0.05 compared with siRNA control in cells transfected 12h after OGDR (OGDR12h + Con siRNA). b Quantitative real-time PCR was performed to detect the mRNA levels of TNF-α, IL-1β, iNOS, and IL-10 in cells transfected with TREM2 siRNA 6h and 12h after OGDR. Quantified fold changes are shown as mean ± SEM; n = 6; * P < 0.05 compared with control group; # P < 0.05 compared with OGDR 6h + Con siRNA group; Δ P < 0.05 compared with OGDR 12h + Con siRNA group. c Overexpression of TREM2 6h and 12h after OGDR. TREM2 protein levels were measured by western blotting. Densitometric analysis of TREM2 relative to GAPDH is shown as mean ± SEM; n = 5; * P < 0.05 compared with control group; # P < 0.05 compared with pcDNA vector control transfected 6h after OGDR (pcDNA group); Δ P < 0.05 compared with pcDNA vector control transfected 12h after OGDR. d Quantitative real-time PCR was performed to detect the mRNA levels of inflammatory factors following TREM2 overexpression 6h and 12h after OGDR. Quantified fold changes are shown as mean ± SEM; n = 6; * P < 0.05 compared with control group; # P < 0.05 compared with pcDNA vector control transfected 6h after OGDR group; Δ P < 0.05 compared with pcDNA vector control transfected 12h after OGDR group

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques: Transfection, Western Blot, Control, Real-time Polymerase Chain Reaction, Over Expression, Plasmid Preparation

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: Inhibition of TREM2 facilitates the inflammation induced by ischemia in MCAO mice. MCAO mice were injected with TREM2 siRNA or control siRNA. Tissue homogenates from ischemic cerebral hemisphere (ischemic core and penumbra) of 7 days mice after MCAO under the indicated treatments were subjected to ( a ) quantitative real-time PCR with primers of TNF-α, IL-1β, and IL-10 or ( b ) enzyme-linked immunosorbent assays for TNF-α, IL-1β, and IL-10. Quantified data are shown as mean ± SEM; n = 6; * P < 0.05,levels of TNF-α, IL-1β, and IL-10 compared with those in the sham group; # P < 0.05 compared with the control siRNA group injected for 7 days after MCAO

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques: Inhibition, Injection, Control, Real-time Polymerase Chain Reaction

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: a Representative images of cells subjected to OGDR and transfected with either TREM2 siRNA or a TREM2 overexpression plasmid were immunostained with NeuN ( red ) and TUNEL ( green ). Scale bar, 50 μm. b The percentage of apoptotic neurons was calculated using image analysis software. Quantified data are shown as mean ± SEM; n = 5; * P < 0.05 compared with control group; # P < 0.05 compared with the control siRNA or overexpressing vector groups 12h after OGDR

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques: Transfection, Over Expression, Plasmid Preparation, TUNEL Assay, Software, Control

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: Signaling pathways of TREM2 protection against cerebral injury. a TREM2, p-ERK1/2, ERK1/2, p-NF-κB and NF-κB protein expression in cultured primary microglial cells were determined by western blotting 12h after OGDR, with or without transfection TREM2 siRNA or control. e These protein expression also in mice (sham, MCAO7d, sham + TREM2 siRNA, MCAO7d + TREM2 siRNA) were determined by western blot. Densitometric analyses of TREM2 versus β-Tublin ( b , f ), p-ERK1/2 versus ERK1/2 ( c , g ) and p-NF-κB versus NF-κB ( d , h ) were show as mean ± SEM; n = 5; # P < 0.05 compared control (normal) cells or the sham (sham + TREM2 siRNA) groups; * P < 0.05 compared with OGDR 12h cells transfected with control siRNA or MCAO7d mice; Δ P < 0.05 compared sham transfected with TREM2 siRNA to sham mice

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques: Protein-Protein interactions, Expressing, Cell Culture, Western Blot, Transfection, Control

Journal: Molecular Brain

Article Title: TREM2 protects against cerebral ischemia/reperfusion injury

doi: 10.1186/s13041-017-0296-9

Figure Lengend Snippet: Schematic representation of the role of TREM2 in cerebral ischemia/reperfusion injury

Article Snippet: The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer.

Techniques:

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with siRNA for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Expressing, Translocation Assay, Transfection, Microscopy, Software, Over Expression, Marker, Knockdown, Cell Culture

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Par3 promotes YAP dephosphorylation and activation, regulating YAP target gene expression and cell proliferation. ( a ) Par3 reduced YAP phosphorylation at Ser127. 293T cells were transfected with FLAG-Par3 and HA-YAP, and the pYAP Ser127 site was detected. The data are representative of three independent experiments, *** P <0.001. ( b ) Par3 knockdown increased YAP phosphorylation at low cell density but not at high cell density. MDCK II cells were transfected with two different siRNAs for Par3 at low and high cell densities, and total YAP and pYAP Ser127 sites were detected. The data are representative of three independent experiments, *** P <0.001, ** P <0.01. ( c ) Par3 knockdown inhibited YAP target genes Ankrd1, Ctgf, Cyr61 and Inhba at low cell density but not at high cell density. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low and high cell densities. ( d ) Par3 knockdown inhibited cell proliferation, whereas overexpression of YAP active forms and YAP S127A rescued the inhibition by Par3 knockdown in MDCK II cells. An MTT assay was performed in MDCK II cells, and Par3 and HA-YAP and YAP/S127A expression levels were determined by western blotting. ( e , f ) Deleted PDZ3 domain of Par3 could not reduce YAP phosphorylation and deleted PDZ motif of YAP could not be regulated by Par3. 293T cells were transfected with indicated plasmids. ( g ) The inhibition of YAP target genes ( Ankrd1, Ctgf, Cyr61, Diaph1 and Inhba ) by Par3 knockdown at low density could be partially rescued by Par3, but not by Par3 ΔPDZ3. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low density.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: De-Phosphorylation Assay, Activation Assay, Targeted Gene Expression, Phospho-proteomics, Transfection, Knockdown, Quantitative RT-PCR, Over Expression, Inhibition, MTT Assay, Expressing, Western Blot

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Par3 interacts with LATS1/2, YAP and PP1A and promotes dephosphorylation of LATS1 and YAP. ( a ) Overexpression of Par3 and PDZ deletion mutants decreased LATS1 phosphorylation at Ser909. 293T cells were transfected with the indicated plasmids, and pLATS Ser909 was determined by western blotting. ( b ) The reduction of YAP phosphorylation by Par3 overexpression was weakened when LATS1/2 was knocked down. 293T cells were transfected with FLAG-Par3 and siRNA for LATS1/2; western blot analysis was performed as indicated. ( c ) The increment of YAP phosphorylation by Par3 knockdown was attenuated by LATS1/2 knockdown. MDCK II cells were transfected with siRNA for Par3 or LATS1/2; western blot analysis was performed as indicated. ( d ) Par3 interacted with LATS1 and PP1A. Co-immunoprecipitation was conducted with anti-FLAG antibodies in 293T cells, which were transfected with GFP-Par3, FLAG-LATS1 and FLAG-PP1A. ( e ) Par3 promoted the interaction of YAP and PP1A. IP was conducted with anti-YAP antibodies in 293T cells transfected with FLAG-Par3, and endogenous PP1A was subjected to western blot analysis. ( f ) Par3 knockdown reduced the interaction of LATS1 and PP1A. IP was performed with anti-LATS1 antibodies in 293T cells transfected with siPar3, and western blot analysis was performed as indicated. All experiments were performed at low cell density. ( g ) LATS1 and PP1A mainly localized in the nucleus at a low cell density. Cell fractionations were performed with MDCK II cells at low cell density. Western blot analysis was performed as indicated. ( h ) YAP interacts with Par3, LATS1 and PP1A in the nucleus and cytoplasm. IP with anti-YAP antibodies was conducted with the nuclear and cytoplasmic fractions of MDCK II cells at low cell density. Western blot analysis was performed as indicated.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: De-Phosphorylation Assay, Over Expression, Phospho-proteomics, Transfection, Western Blot, Knockdown, Immunoprecipitation

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Dual function of Par3 in regulating YAP phosphorylation and activation . ( a ) PP1A knockdown alone increased YAP and LATS1 phosphorylation, and PP1A knockdown plus Par3 overexpression promoted more the increased phosphorylation of YAP and LATS1. 293T cells were transfected with two different siRNAs for PP1A and FLAG-Par3 plasmids. Western blot analysis was performed as indicated. ( b ) PP1A knockdown inhibited YAP target genes Anln, Ankrd1, Ctgf and Diaph1 , and Par3 overexpression enhanced the inhibition of YAP target genes by PP1A knockdown. RT-qPCR was performed in 293T cells transfected with siRNA for PP1A and FLAG-Par3 at low cell density. ( c ) PP1A knockdown inhibited cell proliferation, and Par3 overexpression enhanced the inhibition of cell proliferation by PP1A knockdown, as assessed by an EdU assay. Total cell number was measured by 4′, 6-diamidino-2-phenylindole (blue), and cells in mitosis were labeled by EdU (green). Scale bar: 100 um. MDCK II cells were transfected with siRNA for PP1A and FLAG-Par3 plasmids for 2 days and were then cultured with normal medium containing 10 μ M EdU for 30 min. Cells were then stained according to the Click-iT EdU Alexa Fluor 488 Imaging Kit (C10337) protocol from Invitrogen. ( d ) The ratio of EdU-positive cells/total cells was determined.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Phospho-proteomics, Activation Assay, Knockdown, Over Expression, Transfection, Western Blot, Inhibition, Quantitative RT-PCR, EdU Assay, Labeling, Cell Culture, Staining, Imaging

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: YAP activation by Par3 is differentially regulated in tumor cell lines . ( a ) Par3, YAP and PP1A expression patterns were different in different cell lines. The lung cell lines A549, 5810, 5844, 5883, 5928 and HepG2 were harvested for western blotting, and analyses were performed as indicated. ( b ) In the 5928 cell line, Par3 decreases YAP phosphorylation, as in 293T cells. 5928 cells were transfected with FLAG-Par3, and pYAP Ser127 was detected. ( c ) The YAP target genes Anln, Ankrd1, Ctgf and Cyr61 were upregulated when Par3 was overexpressed. RT-qPCR was performed in 5928 cells transfected with FLAG-Par3 at low cell density. ( d ) In the 5803 cell line, Par3 increased YAP phosphorylation and reduced YAP protein levels. 5803 cells were transfected with FLAG-Par3, and pYAP Ser127 and YAP were detected. ( e ) The YAP target genes Ankrd1, Cyr61, Diaph1 and Inhba were reduced when Par3 was overexpressed in the 5803 cell line. RT-qPCR was performed in 5803 cells transfected with FLAG-Par3 at low cell density.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Activation Assay, Expressing, Western Blot, Phospho-proteomics, Transfection, Quantitative RT-PCR

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: The hypothetical model for the dual function of Par3 in regulating YAP phosphorylation and activation. At high cell density, Par3 and YAP co-localize in the TJs at the cell–cell contact and Par3 has no effect on YAP phosphorylation (left panel). At low cell density, or calcium depletion, HGF stimulation/γ-irradiation, phosphorylated Par3 by Par1 translocates from membrane to the cytoplasm(①) or the nucleus (②). Cytoplasmic or nuclear Par3 recruits PP1A to dephosphorylate LATS1, promoting YAP activity (right panel). When PP1A is knocked down or Par3’s spatial localization is disordered, Par3 expression induces YAP hyperphosphorylation and degradation (③).

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Phospho-proteomics, Activation Assay, Irradiation, Membrane, Activity Assay, Expressing

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 is a LncRNA whose expression changed during adipogenic and osteogenic differentiation. Hierarchical clustering of 1113 differentially (≥3-fold) expressed LncRNAs in primary marrow stromal cells 72 h after adipogenic treatment is shown (a). The location of PGC1β-OT1 on the Chromosome 18 is shown (b). 5′- and 3′-rapid amplification of cDNA ends and RT-PCR assays were performed to determine the full-length of PGC1β-OT1 (c). Coding potential calculator predicted the lack of coding ability of PGC1β-OT1. LncRNA H19 and protein-coding PGC1β and β-actin were also predicted as controls (d). qRT-PCR was performed to analyze PGC1β-OT1 levels in cytoplasmic (Cyt) and nuclear (Nuc) fractions (e). RNA expression profiles of PGC1β-OT1 during adipocyte (f) and osteoblast differentiation (g) are shown. Levels of PGC1β-OT1 in undifferentiated cells (day 0) are set as 1. Data are mean ± SD, n = 3. *p < 0.05 vs. Cyt (e) or vs. day 0 (f, g). LncRNA long noncoding RNA

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Expressing, Rapid Amplification of cDNA Ends, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, RNA Expression

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 negatively regulated adipocyte differentiation in stromal ST2 cells. qRT-PCR analysis verified the overexpression of PGC1β-OT1 (a) or knockdown of PGC1β-OT1 (f) in ST2. Effects of PGC1β-OT1 overexpression (b−e) or silencing (g−j) on adipocyte differentiation were examined. Differentiated adipocytes were stained with oil red O (b, g). Oil red O extracted with isopropanol was measured at OD520 (c, h). The mRNA (d, i) and protein (e, j) levels of adipogenic factors were examined. Magnification, ×200. Data are mean ± SD, n = 3. *p < 0.05 vs. vector or small-interfering RNA negative control (NC)

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Quantitative RT-PCR, Over Expression, Staining, Plasmid Preparation, Small Interfering RNA, Negative Control

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 positively regulated osteoblast differentiation in stromal ST2 cells. Effects of PGC1β-OT1 overexpression (a−c) or silencing (d−f) on osteoblast differentiation were examined in ST2. Differentiated osteoblasts were subjected to alkaline phosphatase staining (a, d). The mRNA (b, e) and protein (c, f) levels of osteogenic factors were examined. Data are mean ± SD, n = 3. *p < 0.05 vs. vector or NC

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Over Expression, Staining, Plasmid Preparation

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 regulated differentiation of primary MSCs in vitro and in vivo. Fluorescence observation was performed to verify infection efficiency in primary MSCs (a). qRT-PCR was performed to verify PGC1β-OT1 knockdown after infection (b). Effects of PGC1β-OT1 silencing on adipogenic (c−f) and osteogenic differentiation (g−i) were examined. Differentiated adipocytes were stained with oil red O (c). Re-dissolved oil red O was measured at OD520 (d). The mRNA (e) and protein (f) levels of adipogenic factors were examined. Differentiated osteoblasts were subjected to alkaline phosphatase staining (g). The mRNA (h) and protein (i) levels of osteogenic factors were examined. qRT-PCR was done to verify the silencing of PGC1β-OT1 in MSCs of mice (j). Hematoxylin and eosin staining was done (k). Numbers (l) and areas (m) of adipocytes were quantified. Representative images of osteocalcin immunohistochemical staining are shown (n, Top: trabeculae; Bottom: endosteum). Numbers of osteoblasts on bone surface of trabeculae (o) and endosteum (p) in metaphysis were quantified. Data are mean ± SD. (a−i), n = 3. *p < 0.05 vs. Lenti-Ctrl. (j−p), n = 6. *p < 0.05 vs. NC. MSC marrow stromal cell

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: In Vitro, In Vivo, Fluorescence, Infection, Quantitative RT-PCR, Staining, Immunohistochemical staining

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 contained functional miR-148a-3p binding site. Base pairing of PGC1β-OT1 with miR-378a-5p or miR-148a-3p is shown (a). Wild-type (WT-Luc) and mutant (Mutant-Luc) luciferase reporter constructs were made (b). miR-378a-5p mimics (c) or miR-148a-3p agomir (d) was cotransfected with WT-Luc or Mutant-Luc into HEK-293 cells and the luciferase activity was assayed. WT or mutant PGC1β-OT1 construct with mutation at miR-148a-3p binding site was transfected into ST2 cells, qRT-PCR was performed to verify the overexpression (e). Oil red O staining (f, g) and qRT-PCR analysis of adipogenic factors (h) were performed. Alkaline phosphatase staining (i) and qRT-PCR analysis of osteogenic factors (j) were performed. Data are mean ± SD, n = 3. *p < 0.05 vs. vector

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Functional Assay, Binding Assay, Mutagenesis, Luciferase, Construct, Activity Assay, Transfection, Quantitative RT-PCR, Over Expression, Staining, Plasmid Preparation

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 physically associated with miR-148a-3p. Schematic outline of purification of PGC1β-OT1-associated microRNA ribonucleoprotein complex and RNA component identification (a). After transfection of single construct, in vivo crosslinking was done followed by affinity purification of PGC1β-OT1-associated miRNAs. Relative abundance of PGC1β-OT1, PGC1β-OT1-mut, and β-actin RNA (b) or relative abundance of miR-148a-3p and U6 (c) associated with tagged vs. untagged PGC1β-OT1 are plotted as relative fold enrichment. After cotransfection, in vivo crosslinking was done followed by affinity purification, and RNAs were extracted for qRT-PCR. Relative abundance of PGC1β-OT1 and β-actin RNA (d) or relative abundance of miR-148a-3p or U6 (e) associated with tagged vs. untagged PGC1β-OT1 are plotted as relative fold enrichment. Data are mean ± SD, n = 3. *p < 0.05 vs. untagged PGC1β-OT1, #p < 0.05 vs. tagged PGC1β-OT1

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Purification, Transfection, Construct, In Vivo, Affinity Purification, Cotransfection, Quantitative RT-PCR

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 affected expression of endogenous miR-148a-3p and its target KDM6B. The expression profiles of PGC1β-OT1 and miR-148a-3p during adipogenesis were analyzed by qRT-PCR (a). Expression levels of PGC1β-OT1 and miR-148a-3p were examined after transfection of PGC1β-OT1 into ST2 (b). The mRNA (c) and protein (d, e) levels of KDM6B were determined after transfection of PGC1β-OT1, Mut-PGC1β-OT1 or vector into ST2 cells. The protein level of KDM6B was determined in ST2 after transfection of miR-148a-3p or control antagomir (f). Data are mean ± SD, n = 3. *p < 0.05 vs. vector or control antagomir

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation

Journal: Cell Death and Differentiation

Article Title: A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p

doi: 10.1038/s41418-019-0296-7

Figure Lengend Snippet: PGC1β-OT1 regulated differentiation of progenitor cells via its downstream effectors. PGC1β-OT1 construct or the vector was cotransfected with miR-148a-3p or control agomir into ST2, and differentiated adipocytes were stained by oil red O (a). Oil red O extracted with isopropanol was measured at OD520 (b). The mRNA levels of adipogenic factors were examined (c). qRT-PCR analysis was performed to verify the silencing of PGC1β-OT1 and overexpression of Kdm6b (d). siPGC1β-OT1 or control small-interfering RNA was cotransfected with Kdm6b expression construct or vector, and differentiated osteoblasts were subjected to alkaline phosphatase staining (e). The mRNA levels of osteogenic factors were examined (f). Data are mean ± SD, n = 3. *p < 0.05 vs. NC plus Vector. #p < 0.05 vs. miR-148a-3p agomir plus Vector (b, c) or siPGC1β-OT1 plus Vector (f)

Article Snippet: 2′-Ome-modified PGC1β-OT1 siRNA (siRNA2) and control siRNA were purchased from Genepharma (Shanghai, China).

Techniques: Construct, Plasmid Preparation, Staining, Quantitative RT-PCR, Over Expression, Small Interfering RNA, Expressing

Journal: Cell Death & Disease

Article Title: Inhibition of the miR-192/215–Rab11-FIP2 axis suppresses human gastric cancer progression

doi: 10.1038/s41419-018-0785-5

Figure Lengend Snippet: Expression levels of Rab11-FIP2 by IHC in GC, lymphatic metastatic, and adjacent normal tissues

Article Snippet: Human Rab11-FIP2 siRNA (siRNA1, siRNA2, and siRNA3 sequences were listed in the Supplementary Table ) were from Ribobio (Guangzhou, Ribobio, Co., Ltd).

Techniques: Expressing